جستجوی پیشرفته

   
 
Home ثبت نام پرسشهاي متداول ليست اعضا گروههاي کاربران  
 
 
براي تغيير زبان صفحه كليد EN/FA از كليد Scroll Lock بر روي صفحه كليد استفاده نماييد.
فهرست ژنتيك و نانوبيوتكنولوژي بررسي مولکولي ژن لپتين(Leptin) در نژاد گاو سرابي
نمايش پستها:   
      تمام زمانها بر حسب GMT + 4 Hours مي‌باشند  
  ارسال موضوع جديد  پاسخ دادن به اين موضوع

24 اسفند 1386 - 1:53
نويسنده پيام
DVM
كاربر بسيار فعال
كاربر بسيار فعال


عضو شده در: 29 بهمن 1385
پست: 437

عنوان: بررسي مولکولي ژن لپتين(Leptin) در نژاد گاو سرابي پاسخگويي به اين موضوع بهمراه نقل قول

چکیده:
شناخت جنبه های ژنتیکی و ژنهای عمده تاثیر گذار روی بالانس انرژی ، تولید شیر، باروری ایمنی و مصرف خوراک از علاقه مندیهای اخیر محققان اصلاح نژاد می باشد. ژن لپتین از جمله ژنهایی است که چند شکلیهایی موجود در آن با این صفات اقتصادی و مهمی مرتبط می باشد. در این پژوهش نمونه های خون از 66 گاو نژاد سرابی از ایستگاههای سراب و شبستر گرفته شد.استخراج DNA به کمک روش (Boom1989)و واکنش زنجیره پلی مراز(PCR) جهت تکثیر قطعه 422 جفت بازی از اینترون 2 این ژن انجام گرفت. قطعه تکثیر شده بوسیله آنزیم محدودالاثرSau3AIجهت تشخیص ژنوتیپهای ژن لپتین مورد هضم آنزیمی قرار گرفت. ژنوتیپهای AA ،AB و BB بترتیب به تعداد 15،14و 6 در ایستگاه سراب و 6،14 و 11 در ایستگاه شبستر تشخیص داده شدند. فراوانی آللی نیز برای آللهای A,B بترتیب 63/0 و 37/0 در ایستگاه سراب و 42/0 و 58/0 در ایستگاه شبستر برآورد گردید. مقایسه فراوانی اللB(الل مطلوب) در گاوهای بومی سرابی با تحقیقات مشابه در نژادهای مختلف در دنیا، نشان داد که فراوانی این الل در گاوهای سرابی در سطح مناسبی میی باشد. تعادل هاردی-واینبرگ نیز در هر دو جمعیت برقرار بود.
مقدمه:
انتخاب گاوهای شیرده برای افزایش تولید شیر، متعاقبا بعضی خصوصیات تولید مثلی این گاوها را کاهش می دهد. مقالات مختلفی وجود همبستگی ژنتیکی بین تعادل انرژی، تولید شیر و شروع فعالیت تولید مثلی را گزارش کردند. لپتین در حال گردش خون، دارای 146 اسید امینه می باشد. اعتقاد بر این است که لپتین عمده ترین کنترل کننده اشتها، متابولیسم انرژی، باروری، ایمنی، افزایش وزن می باشد. ژن لپتین گاو دارای سه اگزون و دو اینترون می باشد و در روی کروموزوم شماره 4 گاو واقع شده است. لاندرسون و همکاران(1998) مکانهای کنترل کننده صفات کمی برای صفات تولید شیر در 8/82 سانتی مورگان و برای درصد چربی و پروتئین شیر در 75 و 95 سانتی مورگانی این ژن مکان یابی کردند.لیفرز و همکاران (2002) گزارش کردند که تلیسه های با ژنوتیپ AB و 32/1 کیلوگرم در روز شیر نسبت به ژنوتیپ AA تولید کردند. همچنین نشان دادند که الل B باعث افزایش تولید شیر بدون ایجاد تعادل منفی انرژی و کاهش بیش از حد باروری در گاوهای هلشتاین می شود. فراوانیهای ژنوتیپی آنها 3/81، 5/18 و 2/0 درصد بترتیب برای AA , AB و BB گزارش شده است. Almeida و همکاران (2003) گزارش کردند که اللهای یک RFLP-Sau3AI باعث افزایش فاصله گوساله زائی به مدت 81-79 روز می شود بنابراین انتخاب بر اساس موتاسیونهای این ژن، حداقل 2 ماه باعث کاهش فاصله نسلی می شود. افراد هتروزیگوت، وزن تولد بالاتری را در اولین گوساله زائی، نسبت به ژنوتیپهای هتروزیگوت داشتند.Langonigro و همکاران (2002) گزارش کردند که افراد با ژنوتیپ AT حدود 19% مصرف خوراک بیشتری نسبت به افراد AA از خود نشان می دهد. Zwierzchowsk و همکاران (2002) با استفاده از تکندنیک PCR-RFLP به بررسی فراوانی آللی این ژن پرداختند. ابتدا یک قطعه 1820 جفت بازی از ژن لپتین را تکثیر کرده و سپس توسط آنزیم Sau3AI مورد هضم قرار دادند که نتیجه آن تشخیص سه آلل A, B و C با فراوانی 79/0،11/0و10/0 بود. تحقیق حاضر، به منظور شناسایی ژنوتیپهای ژن لپتین و فراوانی اللهای آن در گاوهای نژاد سرابی بکمک روش مولکولی PCR اجرا و بهینه گردید.
مواد و روشها:
از تعداد 66 راس گاو سرابی از هر دو جنس نمونه خون از ایستگاههای پرورش و اصلاح گاو سرابی واقع در شبستر و سراب گرفته شده.خونگیری در گاوهای بزرگ از ورید دمی و در گوساله ها از ورید وداج صورت گرفت. سپس نمونه ها از مزرعه داخل لوله های حاوی خلا و EDTA همراه با یخ به آزمایشگاه مولکولی اصلاح نباتات دانشگاه تبریز گردید و تا زمان استخراج DNA در 20- درجه سانتی گراد نگهداری گردیدند. استخراج DNA از خون تام با استفاده از روش .Boom و همکاران (1989) با استفاده از کیت Iso Gene Moscow) Diatom) انجام گرفت. این روش مبتنی بر استفاده از ماده لیز کننده کوانیدین تیوسیانات و جذب کننده سیلیکاژل می باشد. بدین منظور ابتدا 200 میکرولیتر از خون برداشته سپس 500 میکرولیتر بافر هضم کننده ( 5M گوانیدین تیوسیانات، EDTA20mM, Tris 40mM و40 گرم TritonX100 و 10 گرمDTT) به نمونه اضافه شده ، نمونه ها به مدت 5 دقیقه در بن ما ری حاوی 65 درجه سانتی گراد انکوبه گردیدند. سپس 20 میکرولیتر محلول نوکلئاز (4 گرم ذرات سیلیکا، 100 میکرولیتر گوانیدین) اضافه شد و به مدت 10 دقیقه به آرامی ورتکس گردید. سپس به محیط همگن شده، 400 میکرولیتر بافرسالین (Tris-HCL 10mM , EDTA 20mM,NaCl 1M, KCl 1M ) اضافه و در نهایت از طریق ماده Extra Gene (رزین 10% ، OrangG ماده رنگی20/0% ، 10/0 درصد Triton X 100) و DNA زرد رنگ از سایر ناخالصیها جدا گردید. جهت تعیین غلظت نمونه های استخراج DNA شده، از روش الکتروفورز مقایسه ای آگارز با استفاده از مقادیر مشخصی DNA فاژ لامبدا و الکتروفورز استفاده گردید.آغازگرهای این مقاله توسط تیم تحقیقاتی دانشگاه واخنیگن هلند که سرپرستی آن را دکتر S.C.Liefers بر عهده دارد، طراحی گردیده است.
آغازگرها دو جفت 24 نوکلئوتیدی بودند که قطعه ای بطول 422 جفت باز از اینترون دو ژن لپتین گاوی را تکثیر می نمایند. در داخل این قطعه دو سایت برشی برای آنزیم Sau3AI (یک سایت مونومورف و یک سایت اصلی پلی مورف) وجود دارد. برای بررسی صحت طراحی آغازگرها از نرم افزار DNAsis و Primer premier استفاده شد. ساخت پرایمرها توسط شرکت SYNTOL ( مسکو ) صورت پذیرفت. توالی مورد تکثیر در ژن بانک (EMBL) با شماره Y11369.1 ثبت شده است. توالی پرایمرهای مورد استفاده عبارتند از:

Forward primer: 3' - TGGAGTGGCTTGTTATTTTCTTCT-5'
Reverse primer: 5- GTCCCCGCTTCTGGCTACCTAACT -3


انجام واکنش زنجیره ای پلیمراز بکمک کیت لیوفیلزه Iso Gene - Moscow) PCR Universal) که حاوی Mix، Diluent PCR و Mineral Oil بود بروش استاندارد انجام گرفت. غلظت نهایی مواد در 25 میکرولیتر عبارت بودند از : یک واحد آنزیم Polymerase Taq و 200 میکرومول از هر dNTP و 200 میلی مول MgCl2 و 20-10 پیکامول مخلوط پرایمرها و 100-50 نانوگرم DNA و بافر استاندارد. واکنش PCR با برنامه حرارتی زیر به تعداد 35 سیکل در دستگاه ترموسایکلر (UNIOII) انجام شد. برنامه حرارتی عبارت بود از: 94 درجه سانتیگراد جهت واسرشته شدن DNA بمدت 45 ثانیه، دمای 55 درجه سانتیگراد جهت اتصال پرایمرها بمدت 1 دقیقه و دمای 72 درجه سانتیگراد جهت سنتز بمدت 1 دقیقه جهش نقطه ای اتفاق افتاده (C → G) در موقعیت 3100 جفت بازی اینترون 2 ژن لپتین برای آنزیم محدودالاثر Sau3AI ایجاد یک محل اثر جدید نموده است که با هضم آنزیمی تشخیص ژنوتیپهای مختلف فراهم خواهد شد. هضم آنزیمی در حجم 30 میکرولیتر با مصرف 15 واحد آنزیمی تحت شرایط بافری و دمای مناسب با استفاده از آنزیم برشی Sau3AI که سایت برشی GATC را شناسایی می کند انجام گرفت. هنگام هضم آنزیمی محصولات PCR، در صورت هتروزیگوت بودن (AB)، قطعات 390، 303، 88 و 32 جفت بازی حاصل می شود و در صورت هموزایگوسیتی AA قطعات 390 و32و هموزایگوسیتی BB قطعات 303، 88 و32 جفت بازی بدست خواهد آمد. جهت مشاهده محصولات PCR از ژل آگارز 8/1% و ولتاژ 100-70 ولت بمدت 2 ساعت استفاده شد. رنگ آمیزی ژل با اتیدیوم بروماید(10ml/mg)انجام گرفت. قطعه تکثیر شده زیر لامپ UV با طول موج 230 نانومتر مشاهده و عکسبرداری توسط دستگاه مدل Biometra صورت گرفت. برای مشاهده قطعات هضم شده نیز ژل اکریلاماید 12% درصد تهیه و نمونه ها همراه بافر سنگین کننده در چاهک ژل قرار داده شدند. الکتروفورز با ولتاژ و 60 بمدت 4 ساعت انجام شد و پس از آن رنگ آمیزی بکمک نیترات نقره صورت گرفت. باندهای 390 و 303 بخوبی قابل رویت و قابل تعیین ژنوتیپ کردن بودند. برای برآورد فراوانی آللها، محاسبه هتروزایگوسیتی و آزمون χ2 از نرم افزار Popgene32 استفاده گردید.
نتایج:
استفاده از روش Boom و همکاران (1989) برای استخراج DNA از نمونه خون برتری خوبی را در استحصال DNA نشان داد. تکثیر قطعه 422 جفت بازی از اینترون 2 ژن لپتین بکمک واکنش زنجیره ای پلی مراز با استفاده از آغازگرهای اختصاصی بخوبی صورت گرفت. با استفاده از برنامه حرارتی مناسب، آغازگرهای اختصاصی و شرایط خوب آزمایشگاهی فراهم شده، قطعه 422 جفت باز بدون قطعات غیر اختصاصی، بدست آمد. دامهای هتروزیگوت دارای قطعات 390 و 303و هموزیگوتها (AAوBB) بترتیب دارای قطعات 309 و 303 جفت باز هستند. برای برآورد فراوانی آلل ها، محاسبه هتروزاگوسیتی و تست χ2 از نرم افزار PopGene استفاده گردید. تعدا ژنوتیپهای مختلف و فراوانی اللی ژن لپتین در جدول یک برای ایستگاههای سراب و شبستر آورده شده است. همانطور که در جدول یک مشاهده می شود، بیشترین فراوانی آللی در ایستگاه سراب مربوط به آلل A به اندازه 63/0 و در ایستگاه شبستر به الل Bبه اندازه 58/0 میباشد. در مجموع فراوانی آللی در دو ایستگاه نشان داد که درصد فراوانی آلل A به اندازه 4% بیشتر از درصد فراوانی الل B می باشد. این نتیجه با نتیجه Zwierzchowsk و همکاران (2002) در نژاد لهستانی مغایرت دارد و با نتایج Pomo و همکاران(1994) در نژادهای هرفورد همسانی دارد. تست χ2 نشان داد که تعادل هاردی - واینبرگ در جمعیت ایستگاه های سراب و شبستر برای ژن لپتین برقرار است. مقایسه متوسط فراوانی آللهای A و B بدست آمده در نژاد سرابی با نژادهای لهستانی(11)، هلشتاین (6)، گرل بویچ سمینتال، لیموزین و هرفورد(13) نشان می دهد که فراوانی آلل A در اکثر نژادها بیشتر از آلل B می باشد. بالا بودن فراوانی آللی B، شایستگی نژاد سرابی را از نظر جایگاه ژنی نسبت به سایر نژادهای تجاری دنیا ثابت می کند.
بحث:
منابع مختلف آلل B را بعنوان آلل خوب و مطلوب جهت اصلاح نژاد معرفی کردند. لذا با توجه به اینکه فراوانی این آلل در جمعیتهای سرابی از فراوانی متوسطی برخوردار است، بنابراین استفاده از پتانسیلهای نژادهای بومی داین جمعیت از اهمیت خاصی برخوردار است. تست هاردی - واینبرگ در هر دو جمعیت متعادل بودن را نشان می دهد که ممکن است بعلت عدم انتخاب به نفع این ژن باشد.همچنین هتروزاگوسیتی متوسطی که در هر دو جمعیت سراب و شبستر بدست آمده نشان دهنده تنوع پایین این جایگاه ژنی در جمعیت سرابی است. شاید بتوان علت را در بسته بودن جمعیتها و عدم استفاده از گاو نر سایر گله ها بیان کرد. با توجه به پتانسیل بالای ژنتیکی دامهای بومی کشور و وجود فراوانی بالای آللهای مطلوب ضرورت حفظ و استفاده از این پتانسیلها احساس می شود.

Molecular Analysis of the Bovine Leptin Gene in Iranian Sarabi Cattle
(Iranian Bos Taurus)

Summary:
There is evidence of a genetic correlation between energy balance, milk yield and state of luteal activity. Leptin is a 16 kD protein that synthesis by white adipose tissue and it involves in regulation of feed Intake, energy balance, fertility and immune function. In cattle, the leptin gene is located on chromosome four. It consists out of 3 exons and 2 introns of which only 2 exon are translated in to protein. In total 66 animals from Sarab and shabestar stations were genotyped for this project. A strategy employing polymerase chain reaction was used to amplify a 422-bp fragment of intron 2 from blood DNA. Digestion of amplicons with sau3AI revealed two alleles: allele A had 2 fragments 390and 32 bp and allele B had 3 fragments 303, 88 and 32(88 and 32 fragment have not detected on the gel). Three patterns were observed. Frequencies were 0.31, 0.43 and 0.15 for AA, AB and BB respectively. This polymorphism could be evaluated for marker assisted selection and the developed PCR method would expedite screening for large number of animals for such these studies.
Key words: leptin, polymorphism, PCR-RFLP
آرش جوانمرد، قربان الیاسی زرین قبایی ، علی اکبر قره داغی، محمدرضانصیری ، احد ایازی ، نادر اسدزاده ، علی جوادمنش
 
      Back To Top  
   ارسال موضوع جديد  پاسخ دادن به اين موضوع

 
شما نمي توانيد در اين بخش موضوع جديد پست كنيد
شما نمي توانيد در اين بخش به موضوعها پاسخ دهيد
شما نمي توانيد موضوع هاي خودتان را در اين بخش ويرايش كنيد
شما نمي توانيد موضوع هاي خودتان را در اين بخش حذف كنيد
شما نمي توانيد در اين بخش راي دهيد


      Back To Top  

صفحه 1 از 1
   
Powered by Ardalan Online © 2004,2005
پشتيباني توسط : مؤسسه پارس نگار